Illustration of positions of universal primers (ITS1 and ITS4) and... | Download Scientific Diagram
of primers used. ITS4 and ITS5 are standard primers for amplifying the... | Download Scientific Diagram
PCR products amplified with ITS1-ITS4 primers from six strains of... | Download Scientific Diagram
Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies | PLOS ONE
Sizes of ITS1-ITS4 PCR products for Candida species before and after... | Download Table
PCR using primers ITS1 and ITS4. Lanes: 1, primers alone; 2, human DNA;... | Download Scientific Diagram
![Internal Transcribed spacer (ITS) region primers ITS1 and ITS 4 [8]... | Download Scientific Diagram](https://www.researchgate.net/publication/264669072/figure/fig1/AS:614269146112029@1523464585883/Internal-Transcribed-spacer-ITS-region-primers-ITS1-and-ITS-4-8-used-for.png "Internal Transcribed spacer (ITS) region primers ITS1 and ITS 4 [8]... | Download Scientific Diagram")
Internal Transcribed spacer (ITS) region primers ITS1 and ITS 4 [8]... | Download Scientific Diagram
UNITE - Notes and News
Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR | Journal of Clinical Microbiology
Universal Sequence Primer TGAATCATCGACTCTTTGAACGC Forward (ITS1)... | Download Scientific Diagram
ITS as an environmental DNA barcode for fungi: an in silico approach reveals potential PCR biases | BMC Microbiology | Full Text
Sizes of ITS1-ITS4 PCR products for 6 Candida species, Aspergillus... | Download Table
Selection and Experimental Evaluation of Universal Primers to Study the Fungal Microbiome of Higher Plants | Phytobiomes Journal
Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts | BMC Microbiology | Full Text
Oomycete-specific ITS primers for identification and metabarcoding
Oligonucleotides
Primers of the ITS1 and ITS2 regions tested in this study | Download Table
PCR amplification using primer pair ITS1 and ITS4 showing amplification... | Download Scientific Diagram
Accurate Estimation of Fungal Diversity and Abundance through Improved Lineage-Specific Primers Optimized for Illumina Amplicon Sequencing | Applied and Environmental Microbiology
PCR amplification of fungal strain DNA using universal (ITS1/ITS4, (A))... | Download Scientific Diagram
Conserved primer sequences for PCR amplification of fungal rDNA | Vilgalys Mycology Lab - Duke University
PCR-amplified products using ITS1 and ITS4 primers on Erysiphe (Sect.... | Download Scientific Diagram
Structure of the rDNA gene in fungi indicating the two regions that... | Download Scientific Diagram
Location of the primers ITS1 ext B and ITS4 ext A used for... | Download Scientific Diagram
High-Coverage ITS Primers for the DNA-Based Identification of Ascomycetes and Basidiomycetes in Environmental Samples | PLOS ONE
